 Haplogroup R1b Distribution In human genetics, Haplogroup R1b is the most frequently occurring Y-chromosome haplogroup in Western Europe. More specifically, R1b's frequency is highest in the populations of Atlantic Europe and, due to European emigration, in North America, South America, and Australia. In Ireland and the Basque Country its frequency exceeds 90% and approaches 100% in Western Ireland. [http://www.roperld.com/YBiallelicHaplogroups.htm] The incidence of R1b is 70% or more in parts of northern and western England, northern Spain, northern Portugal, western France, Wales, Scotland. R1b's incidence declines gradually with distance from these areas but it is still common across the central areas of Europe. R1b is the most frequent haplogroup in Germany, and is common in southern Scandinavia and in Italy. R1b is also present at lower frequencies throughout Eastern Europe, Western Asia, and parts of North Africa and appears in an isolated pocket of Sub-Saharan Africa. Haplogroup R1b is defined by the presence of single-nucleotide polymorphism (SNP) M343, which was discovered in 2004. From 2002 to 2005, R1b was defined by the presence of SNP P25. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18. OriginsIn 2008 T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP. R1b* (that is R1b with no subsequent mutations) is extremely rare. Examples have been found in Europe and Western Asia, for example two in a sample from Turkey. However it is possible that some or all examples represent a reversion of marker P25 from R1b1*. Most examples of R1b fall into its much more recent subclades.
It was initially believed that R1b originated in western Europe where (considered as a whole, including subclades) it reaches its highest frequencies. However R1b's variance increases as one moves east, leading to the view that R1b originated further east. Some geneticists now believe that R1b arose in Central Asia or Western Asia.SubcladesR1b is a descendant of Haplogroup R1. Systematic descent-based names of the subclades have been changing rapidly with the discovery of new SNPs clarifying and augmenting the descent tree. The identifiers below are those from the 2009 revision of the ISOGG tree. R1b1R1b1 is defined by the presence of SNP marker P25.
R1b1* is found in Northern Cameroon in west central Africa at a very high frequency, where it is considered to represent an early back-migration from Asia. R1b1 reaches a maximum frequency of more than 90% among the Kirdi. R1* (which seems likely also to be R1b1, though not tested for M343 and P25) was also reported in the Bantu of southern Cameroon, and in Oman, Egypt, and the Hutu of Rwanda. Again the authors of the study felt that their data suggested an ancient back migration from Asia to Africa. Another example of R1b1* was discovered in Guinea-Bissau. Further examples have been found among speakers of a variety of different languages in Sudan.R1b1aR1b1a is defined by the presence of SNP marker M18. Its position in relation to the much more populous sub-clade R1b1b is uncertain. It has been found only at low frequencies in samples from Sardinia and Lebanon.R1b1bR1b1b is defined by the presence of SNP marker P297. In 2008 this polymorphism was recognised to combine M73 and M269 into one R1b1b cluster.R1b1b1R1b1b1 is defined by the presence of SNP marker M73. It has been found in SE Europe and SW Asia[ Dennis Wright - The Irish Type III Website] and at generally low frequencies throughout central Eurasia. Haplogroup R1b1b1 Y-DNA has been found with especially high frequency among Hazaras in Pakistan (8/25 = 32% R1b1b1-M73) and among Bashkirs in southern Russia (62/471 = 13.2% R1b1b1-M73 [0/52 = 0.0% Sterlibashevskiy - 44/80 = 55.0% Abzelilovskiy]), with the highest frequency being found among the Bashkirs of the Abzelilovo region.R1b1b2This subclade is defined by the presence of the M269 marker. It is the subclade most closely corresponding to Haplotype 15. From 2003 to 2005 what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c.
This subgroup, may have existed before the last Ice Age, but can be seen as much younger. Another estimate for R1b1b2 arising is around 5,000 to 8,000 years ago.R1b1b2a1a1This subclade is defined by the presence of the marker U106, also known as S21 and M405. It appears to represent over 25% of R1b.
In Europe, the subclade (including its own subclades) has a distribution running north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in, Italy (3.5%), and Turkey (0.4%). The frequency of this subclade remains unknown in certain parts of Europe such as Iberia and the Balkans.
The age of U106 is around 3,100-3,900 years old.
The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106"). Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.
Downstream of U106 are U198/S29/M467, P107, P89.2, L1/S26/DYS439(null), L5, L6, L48/S162 (with L47 and its L44, L45, L46 subgroups).R1b1b2a1a1aThis subclade is defined by the presence of the marker U198, also known as S29 and M467. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[ The age of U198 is around 2-3,000 years.]R1b1b2a1a1cThis subclade is defined by the presence of the marker L1/S26/DYS439(null). It occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry,[http://ethnoancestry.com/R1b.html] is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or null439.R1b1b2a1a1dThis subclade is defined by the presence of the marker L48/S162 and is also known as R1b1b2a1a4 (by Family Tree DNA - FTDNA). It is the largest subclade of R1b1b2a1a1. As of May 15, 2009, based on FTDNA tests of samples from 256 people, L48 was detected in 146, or 57.0% of those tested. From among those with L48+ results, 90% have DYS390 of 23 or less, while 10% a value of 24 or more. Among those tested L48-, 16% have DYS390 of 23 or less, while 84% a value of 24 or more. Therefore, there seems to be a correlation between values of 23 or lower for DYS390 and L48+, among those tested U106+. The age of L48 is around 2,900-3,100 years old.
R1b1b2a1a1d has a subclade R1b1b2a1a1d1 (defined by the marker L47), which in turn, seems to be including subclades R1b1b2a1a1d1* and R1b1b2a1a1d1a defined by the marker L44. As well, due to the genetic distances among the members so far L47+, the age of this cluster is probably quite old, perhaps 2,700-2,900 years. It is possible that L47 emerged not too long after the L48 "parent" cluster. Preliminary data would strongly suggest that the L48 SNP occurred only a short period of time after the U106 SNP occurred, likely 200 years or less. With limited data for L46+ haplotypes at this point, it would appear that the L47 SNP occurred only a short period of time after the L48 SNP occurred, likely 200 years or less. However, more results and proper statistical analysis will be required. So far, these are only observations based on a few initial results. For the R1b1b2a1a1d1a defined by marker L44, as of May 15, 2009, based on FTDNA tests of samples from the R1b-U106 project, there were 37 test results for L44, with 6 positive (16.2%) and 31 negative. Downstream of L44, L46 has 37 test results, with 6 positive (16.2%) and 31 negative. As well, it is possible that L45 could be downstream of L44 and upstream of 46, but FTDNA has not started testing L45 yet. The age of L46 could be around 1,500 years before present (YBP).R1b1b2a1a2The P312 SNP appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of this SNP relative to the above list.R1b1b2a1a2bThis subclade is defined by the presence of the marker R-M153. It has been found mostly in Basques and Gascons, among whom it represents a sizeable fraction of the Y-DNA pool, though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001) it was described as H102 and included 7 Basques and one Andalusian.R1b1b2a1a2cThis subclade is defined by the presence of the marker R-M167/SRY2627. The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.
In 2000 Rosser also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.
In 2001 Bosch described this marker as H103, in 5 Basques and 5 Catalans.[ Further regional studies have located it in significant amounts in Asturias, Cantabria and Galicia, as well as again among Basques. Cases in the Azores and Latin America have also been reported. In 2008 two research papers by López-Parra] and Adams,[ respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men. ]R1b1b2a1a2dThis subclade is defined by the presence of the marker R-U152 also called S28. Its discovery was announced in 2005 by EthnoAncestry and subsequently identified independently by Sims et al. (2007). Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. It is found from Greece westward to the Bay of Biscay in France, but the percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152. R1b1b2a1a2eThis subclade is defined by the presence of the marker S68 which was reported by in 2007. It has been seen in an individual from Scotland and another from Sweden. This subclade is unlikely to be found in much more than 2% of the R1b population.R1b1b2a1a2fThis subclade is defined by the presence of the marker L21. Early results suggest that it is common in Britain, appears in France, Germany and Scandinavia, but is rare in Iberian or Italian ancestry.R1b1b2a1a2f2This subclade is defined by the presence of the marker M222. It is particularly associated with the Irish and Scots. In this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as it is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.R1b1cR1b1c is defined by the presence of SNP marker M335. This haplogroup was created by the 2008 reorganisation of nomenclature and should not be confused with R1b1b2, which was previously called R1b1c. Its position in relation to the much more populous sub-clade R1b1b is uncertain. The M335 marker was first published in 2004, when one example was discovered in Turkey, which was classified at that time as R1b4.DistributionR1b reaches its highest frequency in Atlantic Europe. Results from studies with small sample sizes should be treated with caution until more thorough testing is completed. Eurasia- In Western Europe, R1b is present in Irish 90-98%,
Basques: 90-95%, Bretons: 80-89%, Scottish: 77%, Catalans: 75%, English: 75%, Belgians: 70%,[ Portuguese: 70%,][ France (Strasbourg): 67.6%, France (Lyon), 66.7%,, Spanish (as a whole): 65%, Italians (continental Italy): 40%, Germans: 39%, Norwegians: 25.9%,] Sicilians: 24.5%, Maltese: 21.9%, Swedes: 20%, Sardinians: 19%.
- In Eastern Europe, R1b is present in Czechs and Slovaks: 35.6%,
Poles: 20%-16.4%, Latvians: 15%,[ Hungarians: 13.3%, Russians: 10%,][ Estonians: 9%,][ Lithuanians: 5%,][ Belarusians: 4.2%, Ukrainians: 2.0%]-18.9%, Sami: 3.9%.[Tambets et al. (2004).]
- In the Balkans, R1b is present in Greeks: 13.5%
-22.8%, Slovenes: 21%,[ Albanians: 17.6%,] Romanians: 13%, Bulgarians: 17.0%,[ 16.3% in Turkey, Croats: 15.7%,][ Haplogroup frequency data in ] Serbs: 10.6%, Herzegovinians: 3.6%, Bosnians: 1.4%.
- Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b1 and R1b1b2 in Bashkirs, although the genetic diversity is low, suggesting a founder effect.
[Lobov et al. (2009)]
- In South Asia, the frequency of R1b is about 7.4% in Pakistan (including 4.5% R1b1b1-M73 and 2.8% R1b1b2-M269), while it is almost not found in India (0.55% R1b1b2-M269).
Haplogroup R1b1b2-M269 has been found in approximately 11% of a sample of Newars in Nepal.
- In the Caucasus, haplogroup R1b may be found in 43 % of Ossetian males
[ and in as many as 32.4% (238/734 P-92R7(xR1a1-SRY10831b)) to 36% (17/47 R1-M173(xR1a1a-M17))] of Armenians. It also has been found with lower frequency among Georgians (6/66 = 9.1% R1b1b2-M269 to 9/63 = 14.3% R1-M173(xR1a1a-M17)) and Balkarians (2/38 = 5.3% R1b1-P25(xR1b1b2-M269) and 3/38 = 7.9% R1b1b2-M269 for a total of 5/38 = 13.2% R1b).
Africa- In Northeast Africa, the frequency of R1b reaches 40% in the Hausa Sudanese,
10% in all of Sudan,[ 20-35% in Chad, and 4.1% in Egyptians.]
HaplotypesAtlantic Modal HaplotypeA common haplotype within R1b is sometimes called the Atlantic Modal Haplotype, or haplotype 15. It reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 70% in Portugal as a whole and more than 90% in NW Portugal, while the highest value is to be found among Spanish Basques. It was discovered prior to many of the SNPs now used to identify subclades of R1b and references to it can be found in some of the older literature. It corresponds most closely with subclade R1b1b2a1a [L11].
Haplotype 35There also exists a haplotype associated with R1b1b2 characterized by DYS393=12 which is known in the literature as Haplotype 35 (ht35), or the Armenian Modal Haplotype.MutationThe technical details of M343 (rs9786184) are:
Nucleotide change: C to A Position (base pair): 402 Total size (base pairs): 424 Forward 5'? 3': tttaacctcctccagctctgca Reverse 5'? 3': acccccacatatctccagg This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.Popular cultureBryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this haplogroup in his book Origins of the British, giving the R1b clan patriarch the Basque name "Ruisko" in honour of what he thought was the Iberian origin of R1b.See also
|
|