In
human genetics,
Haplogroup I is a
Y-chromosome DNA haplogroup, a subgroup of
haplogroup IJ, itself a derivative of
Haplogroup IJK.
Y-DNA Haplogroup I (the letter I, not the number 1) represents nearly one-fifth of the population of Europe. It can be found in the majority of present-day European populations. The greatest density to be found in
Croatia,
Sweden,
Norway,
Bosnia and Herzegovina,
Sardinia,
Denmark,
Germany and
Serbia. With significant numbers in
Iceland,
Finland and
England. The haplogroup is almost non-existent outside of Europe, strongly suggesting that it arose in Europe.
Origins

European LGM refuges, 20 kya.
The TMRCA (time to
most recent common ancestor) for the I
clade, expressed in ky (confidence interval), is 22.2 (15.3-30.0), placing the Haplogroup I founding event approximately contemporaneous with the onset of the
last glacial maximum (LGM) approximately 21 thousand years ago. Some speculate the initial dispersion of this population corresponds to the diffusion of the
Gravettian culture.
Haplogroup I is closely related to
Haplogroup J, which is today most common in
Semitic and
Northeast Caucasian peoples; both Haplogroup I and Haplogroup J have mutations in common making them descendants of
Haplogroup IJ (S2, S22). The divergence of
Haplogroup IJ into its descendant lineages, Haplogroups I and J, however, occurred many thousands of years prior to the first attestations of
Semitic languages, peoples or cultures during the mid-third millennium B.C. Furthermore, the
Semitic languages, and the larger
Afro-Asiatic languages of which they form a part, are most strongly associated with
the M35 lineage of
haplogroup E originating far from the
Levant in
Africa.
Note the TMRCA is an estimate of the time of subclade divergence. Rootsi et al. 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I, they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. With these estimates, they are consistent with Karafet et al. 2008. A recent outlier is Underhill et al. 2007, which calculates the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky. This will need to be explained further, since they further calculate the STR variation age of I1 at only 8.1±1.5 ky.Distribution

Haplogroup I Distribution
Rootsi et al. 2004 suggest that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the ice age.
Haplogroup I Y-chromosomes have also been found among some populations of the
Middle East, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among
Germanic,
Slavic,
Uralic, and
Turkic peoples, as well as among the
Romance-speaking populations of
France,
Romania,
Moldova, and
Sardinia, the
Albanian-speaking population of
Albania, and the
Greek-speaking population of
Greece.It is also found among Iranian population of
Tehran and
Isfahan (with frequency of 34% and 10% respectively).
Within Europe, several populations are distinguished by having a significantly
lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of
Italy and
Switzerland from
Germany and
Sardinia,
Iberia from southern
France and
Normandy,
Greece,
Albania and the
Slavic peoples, and the
Baltic Latvians from the
Finnic Estonians. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).
Studies
Y-DNA haplogroup I has been researched in connection with HIV and AIDS progression. The research resulted in the finding that haplogroup I in general, and no specific subclade, had accelerated progression (in Y haplogroup I individuals) from HIV to AIDS. Suppression therapy also had a diminished effect on such individuals.
Subgroups
The
subclades of Haplogroup I with their defining mutations:
- I-M170 (M170, M258, P19, P38, P212, U179)
- *I1-M253 (M253, M307, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
- ***I2a1-M26 (M26) Typical of the population of the so-called "archaic zone" of Sardinia; also found at low frequencies among populations of Southwest Europe, particularly in Castile, Béarn, and the Basque Country
- ****I2a1a-M161 (M161) Very rare (1 in Puerto Rico)
- ****I2a2a-P41.2 (P41.2/M359.2) Very rare (2 in Bosnia and Herzegovina, 1 in Turkey, 1 in England and 1 in Croatia)
- **I2b-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32)
- ****I2b1a-M284 (M284) Generally limited to a low frequency in Great Britain
- *****I2b1a1-L126 (L126/S165, L137/S166)
- ***I2b2-L38 (L38/S154, L39/S155, L40/S156, L65/S159)
Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..
I-M170
The composite
subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.
Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of
Turkey (8/741),
Adygea (2/138), and
Iraq (1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the
Andalusians (3/103),
French (4/179),
Slovenians (2/55), and the
Saami (1/35).
I-M253

Density map of HG I1. The darkest areas approach only around 45% of the population.
Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern
Norway, southwestern
Sweden, and
Denmark, and rapidly decreasing frequencies toward the edges of the historically
Germanic-influenced world. A notable exception is
Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.
Outside
Fennoscandia, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low
haplotype diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the
French and
Italians, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.
I-M438

Distribution of HG I2a2 (M423) by region.
I-M423
Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the
Western Balkans, most notably in
Dalmatia (50-60%) and
Bosnia-Herzegovina (up to 75%), especially in the Croat population of Bosnia and Herzegovina.
A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in
Fennoscandia, Western and
Southwestern Europe.
I-M26
Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises approximately 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them. It has been found outside of Sardinia only at low frequencies in
Southwest Europe, the
Czech Republic, and the
Republic of Macedonia.
Haplogroup I-M26 is practically absent east of
France and
Italy, while it is found at low but significant frequencies outside of Sardinia in the
Balearic Islands,
Castile, the
Basque Country, the
Pyrenees, southern and western France, and parts of the
Maghreb in
North Africa,
Great Britain, and
Ireland. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the
Basques, but appears to be found at somewhat higher frequencies among the general populations of
Castile in Spain and
Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.
I-M436
The distribution of
Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in
Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by
founder effects and
genetic drift due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of
Lower Saxony. Haplogroup I-M436 has been found in over 4% of the population only in
Germany, the
Netherlands,
Belgium,
Denmark,
England (not including
Cornwall),
Scotland, and the southern tips of
Sweden and
Norway in Northwest Europe; the provinces of
Normandy,
Maine,
Anjou, and
Perche in northwestern
France; the province of
Provence in southeastern France; the regions of
Tuscany,
Umbria, and
Latium in
Italy; and
Moldavia and the area around Russia's
Ryazan Oblast and
Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of
Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of
Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of
Bithynia and
Galatia in
Turkey rather suggests a connection with the ancient
Gauls of
Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of
Nicomedes I of Bithynia.
Haplogroup I-M436 also occurs among approximately 1% of Sardinians.
Specifications of mutation
The technical details of U179 are:
Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca
Testing Strategy
For Haplogroup I,
STR testing, with at least 25 and preferably 40 or more
alleles tested, will allow accurate inference of all currently known Haplogroup I subclade
single nucleotide polymorphisms (SNP). It will also provide necessary resolution to help with identifying close relatives in family history time frames. Once the
STR testing results are available, one should ensure they are posted in a public database for genealogy search as well as research purposes. Then, if the lab indicates you are Haplogroup I, compare the returned
STR values to an existing table of compiled Haplogroup I
haplotypes to determine your specific haplotype (
go to and under Additional Resources, select the link to Modal Haplotypes for Y-Haplogroup I Varieties, then download FounderHaps.xls). Note that FTDNA values for your
STR alleles should be used when comparing to this table. Note also that the previous version of subclade names are used.
At this stage of Haplogroup I research, there is more resolution of sub-groups available through matching
STR alleles with the listed
haplotypes than is available via testing for known subclade SNPs. This has been the situation for a few years now, but hopefully may change when more people undergo SNP testing for some of the newer SNPs that are being discovered.